Role of epithelial-to-mesenchymal transition in the pulmonary fibrosis induced by paraquat in rats

doi:10.5847/wjem.j.1920-8642.2021.03.009

Abstract

Abstract:

BACKGROUND: This study aims to explore the characteristics of the epithelial-to-mesenchymal transition (EMT) process and its underlying molecular mechanisms in the period of paraquat (PQ)-induced pulmonary fibrosis (PF).

METHODS: Picrosirius red staining and collagen volume fraction were utilized to evaluate the pathological changes of PQ-induced PF in rats. Immunohistochemistry, Western blot, and real-time reverse transcriptase-polymerase chain reaction (RT-PCR) were used to measure the protein and gene expression of EMT markers, EMT-associated transcription factors, and regulators of EMT-related pathways, respectively.

RESULTS: The collagen deposition in the alveolar septum and increased PF markers were characteristics of pathological changes in PQ-induced PF, reached a peak on day 14 after PQ poisoning, and then decreased on day 21. The protein and gene expression of the fibrosis marker, EMT markers, transcription factors, and regulators of EMT-related signaling pathways significantly increased at different time points after PQ poisoning compared with corresponding controls (P<0.05), and most of them reached a peak on day 14, followed by a decrease on day 21. The gene expression of EMT markers was significantly correlated with PF markers, transcription factors, and regulators of EMT-related signaling pathways (P<0.05). The mRNA expression of transcription factors was significantly correlated with that of TGF-β1 and Smad2 (P<0.05 or P<0.01), instead of Wnt2 and β-catenin (P>0.05).

CONCLUSIONS: EMT process plays a role in the PQ-induced PF, in which most PF and EMT markers have a peak phenomenon, and its underlying molecular mechanisms might be determined by further studies.

Key words: Pulmonary fibrosis, Paraquat, Epithelial-to-mesenchymal transition, Rats

Jian-hua Yi, Zhao-cai Zhang, Mei-bian Zhang, Xin He, Hao-ran Lin, Hai-wen Huang, Hai-bin Dai, Yu-wen Huang. Role of epithelial-to-mesenchymal transition in the pulmonary fibrosis induced by paraquat in rats[J]. World Journal of Emergency Medicine, 2021, 12(3): 214-220.

Figures/Tables 6

Table 1

Figure 1.

Figure 2.

Figure 3.

Figure 4.

Table 2

References 30

1	Sabzghabaee AM, Eizadi-Mood N, Montazeri K, Yaraghi A, Golabi M. Fatality in paraquat poisoning. Singapore Med J. 2010; 51(6):496-500.
2	Zhang Y, Yu B, Wang N, Li T. Acute poisoning in Shenyang, China: a retrospective and descriptive study from 2012 to 2016. BMJ Open. 2018; 8(8):e021881. doi: 10.1136/bmjopen-2018-021881
3	WHO. Suicide. Available at https://www.who.int/news-room/fact-sheets/detail/suicide.
4	Jiang YF, Kang J, Huang PP, Yao JX, Wang ZH, Jiang L, et al. Evaluation of gastric lavage efficiency and utility using a rapid quantitative method in a swine paraquat poisoning model. World J Emerg Med. 2020; 11(3):174-81. doi: 10.5847/wjem.j.1920-8642.2020.03.008
5	Wang Y, Chen Y, Mao L, Zhao GJ, Hong GL, Li MF, et al. Effects of hemoperfusion and continuous renal replacement therapy on patient survival following paraquat poisoning. PLoS One. 2017; 12(7):e0181207. doi: 10.1371/journal.pone.0181207
6	Xu YG, Lu YQ. Systematic review and meta-analysis of the efficacy and safety of immunosuppressive pulse therapy in the treatment of paraquat poisoning. J Zhejiang Univ Sci B. 2019; 20(7):588-97. doi: 10.1631/jzus.B1800640
7	Hagiwara S, Iwasaka H, Matsumoto S, Noguchi T. An antisense oligonucleotide to HSP47 inhibits paraquatinduced pulmonary fibrosis in rats. Toxicology. 2007; 236(3):199207.
8	Dinis-Oliveira RJ, Duarte JA, Sánchez-Navarro A, Remião F, Bastos ML, Carvalho F. Paraquat poisonings: mechanisms of lung toxicity, clinical features, and treatment. Crit Rev Toxicol. 2008; 38(1):13-71. pmid: 18161502
9	Zeisberg EM, Kalluri R. Origins of cardiac fibroblasts. Circ Res. 2010; 107(12):1304-12. doi: 10.1161/CIRCRESAHA.110.231910
10	Iwano M. EMT and TGF-beta in renal fibrosis. Front Biosci (Schol Ed). 2010; 2:229-38.
11	Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009; 119(6):1420-28. doi: 10.1172/JCI39104
12	Fabro AT, Minatel IO, Rangel MP, Halbwedl I, Parra ER, Capelozzi VL, et al. Usual interstitial pneumonia and smoking-related interstitial fibrosis display epithelial to mesenchymal transition in fibroblastic foci. Respir Med. 2014; 108(9):1377-86. doi: 10.1016/j.rmed.2014.06.008
13	Tanjore H, Xu XC, Polosukhin VV, Degryse AL, Li B, Han W, et al. Contribution of epithelial-derived fibroblasts to bleomycin-induced lung fibrosis. Am J Respir Crit Care Med. 2009; 180(7):657-65. doi: 10.1164/rccm.200903-0322OC
14	Xie H, Tan JT, Wang RL, Meng XX, Tang X, Gao S. Expression and significance of HIF-1α in pulmonary fibrosis induced by paraquat. Exp Biol Med (Maywood). 2013; 238(9):1062-68. doi: 10.1177/1535370213498978
15	Yamada A, Aki T, Unuma K, Funakoshi T, Uemura K. Paraquat induces epithelial-mesenchymal transition-like cellular response resulting in fibrogenesis and the prevention of apoptosis in human pulmonary epithelial cells. PLoS One. 2015; 10(3):e0120192. doi: 10.1371/journal.pone.0120192
16	Tian R, Zhu Y, Yao J, Meng X, Wang J, Xie H, et al. NLRP3 participates in the regulation of EMT in bleomycin-induced pulmonary fibrosis. Exp Cell Res. 2017; 357(2):328-34. doi: 10.1016/j.yexcr.2017.05.028
17	Lamouille S, Xu J, Derynck R. Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 2014; 15(3):178-96. doi: 10.1038/nrm3758
18	Li T, Yang X, Xin S, Cao Y, Wang N. Paraquat poisoning induced pulmonary epithelial mesenchymal transition through Notch1 pathway. Sci Rep. 2017; 7(1):924. doi: 10.1038/s41598-017-01069-9
19	Huang M, Wang YP, Zhu LQ, Cai Q, Li HH, Yang HF. MAPK pathway mediates epithelial-mesenchymal transition induced by paraquat in alveolar epithelial cells. Environ Toxicol. 2016; 31(11):1407-14. doi: 10.1002/tox.v31.11
20	Zhu Y, Wang J, Meng X, Xie H, Tan J, Guo X, et al. A positive feedback loop promotes HIF-1α stability through miR-210-mediated suppression of RUNX3 in paraquat-induced EMT. J Cell Mol Med. 2017; 21(12):3529-39. doi: 10.1111/jcmm.2017.21.issue-12
21	Lu J, Qian Y, Jin W, Tian R, Zhu Y, Wang J, et al. Hypoxia-inducible factor-1α regulates epithelial-to-mesenchymal transition in paraquat-induced pulmonary fibrosis by activating lysyl oxidase. Exp Ther Med. 2018; 15(3):2287-94.
22	Xu Y, Tai W, Qu X, Wu W, Li Z, Deng S, et al. Rapamycin protects against paraquat-induced pulmonary fibrosis: activation of Nrf2 signaling pathway. Biochem Biophys Res Commun. 2017; 490(2):535-40. doi: 10.1016/j.bbrc.2017.06.074
23	Zhu Y, Tan J, Xie H, Wang J, Meng X, Wang R. HIF-1α regulates EMT via the snail and β-catenin pathways in paraquat poisoning-induced early pulmonary fibrosis. J Cell Mol Med. 2016; 20(4):688-97. doi: 10.1111/jcmm.2016.20.issue-4
24	Zhi QM, Sun HC, Qian XM, Nie SN, Xu BH, Tang WJ, et al. Experimental study on lung injury model induced by paraquat poisoning in rats. J Med Postgradu. 2008; 21(2):134-36.
25	Xu L, Xu J, Wang Z. Molecular mechanisms of paraquat-induced acute lung injury: a current review. Drug Chem Toxicol. 2014; 37(2):130-4. doi: 10.3109/01480545.2013.834361
26	Wang J, Zhu Y, Tan J, Meng X, Xie H, Wang R. Lysyl oxidase promotes epithelial-to-mesenchymal transition during paraquat-induced pulmonary fibrosis. Mol Biosyst. 2016; 12(2):499-507. doi: 10.1039/C5MB00698H
27	Han YY, Shen P, Chang WX. Involvement of epithelial-to-mesenchymal transition and associated transforming growth factor-β/Smad signaling in paraquat-induced pulmonary fibrosis. Mol Med Rep. 2015; 12(6):7979-84. doi: 10.3892/mmr.2015.4454
28	Xie L, Zhou D, Xiong J, You J, Zeng Y, Peng L. Paraquat induce pulmonary epithelial-mesenchymal transition through transforming growth factor-β1-dependent mechanism. Exp Toxicol Pathol. 2016; 68(1):69-76. doi: 10.1016/j.etp.2015.09.010
29	Xu GP, Li QQ, Cao XX, Chen Q, Zhao ZH, Diao ZQ, et al. The effect of TGF-β1 and Smad7 gene transfer on the phenotypic changes of rat alveolar epithelial cells. Cell Mol Biol Lett. 2007; 12(3):457-72.
30	Vongphouttha C, Zhu J, Deng S, Tai W, Wu W, Li Z, et al. Rapamycin protects against paraquat-induced pulmonary epithelial-mesenchymal transition via the Wnt/β-catenin signaling pathway. Exp Ther Med. 2018; 15(3):3045-51. doi: 10.3892/etm.2018.5795 pmid: 29599839

Target gene	Primer sequence	Length of the product (bp)
E-cadherin	F: GGGTTGTCTCAGCCAATGTT R: CACCAACACACCCAGCATAG	206
α-SMA	F: AGCCAGTCGCCATCAGGAAC R: CCGGAGCCATTGTCACACAC	242
FSP-1	F: AGGCAACGAGGGTGACAAGTTC R: CATCATGGCAATGCAGGACAG	194
Slug (snail2)	F: GCACTGTGATGCCCAGGCTA R: CCTTGCCACAGATCTTGCAGAC	215
Twist	F: ACCCTCACACCTCTGCATTC R: CAGTTTGATCCCAGCGTTTT	228
TGF-β1	F: ATACGCCTGAGTGGCTGTCT R: TGGGACTGATCCCATTGATT	225
Smad2	F: CCAGGTCTCTTGATGGTCGT R: TCTCCACCCTCTGGTAGTGG	241
Smad7	F: 5'TCCTGCTGTGCAAAGTGTTC3' R: 5'TCTGGACAGTCTGCAGTTGG3'	188
Wnt2	F: GTGTGACAATGTGCCAGGTC R: GTGGTCTCTGTCCAGGGTGT	182
β-catenin	F: GCCAGTGGATTCCGTACTGT R: GAGCTTGCTTTCCTGATTGC	183
GAPDH	F: AGACAGCCGCATCTTCTTGT R: CTTGCCGTGGGTAGAGTCAT	207

Parameters	α-SMA	E-cadherin	Slug	Twist	TGF-β1	Smad2	Wnt2	β-catenin
α-SMA	1	-	-	-	-	-	-	-
E-cadherin	-0.818^*	1	-	-	-	-	-	-
Slug	0.869^*	-0.752^*	1	-	-	-	-	-
Twist	0.922^*	-0.845^*	0.960^#	1	-	-	-	-
TGF-β1	0.955^#	-0.909^#	0.822^*	0.863^*	1	-	-	-
Smad2	0.894^*	-0.818^*	0.971^#	0.993^#	0.971^*	1	-	-
Wnt2	0.869^*	-0.942^#	0.521	0.646	0.800	0.601	1	-
β-catenin	0.797	-0.853^*	0.447	0.579	0.679	0.533	0.959^#	1

[1]	Yi Han, Su-cheng Mu, Jian-li Wang, Wei Wei, Ming Zhu, Shi-lin Du, Min Min, Yun-jie Xu, Zhen-ju Song, Chao-yang Tong. MicroRNA-145 plays a role in mitochondrial dysfunction in alveolar epithelial cells in lipopolysaccharide-induced acute respiratory distress syndrome [J]. World Journal of Emergency Medicine, 2021, 12(1): 54-60.
[2]	Yun-fei Jiang, Jian Kang, Pei-pei Huang, Jia-xi Yao, Zhong-he Wang, Lei Jiang, Jun Wang, Li Qiao, Bao-li Zhu, Hao Sun, Jin-song Zhang. Evaluation of gastric lavage efficiency and utility using a rapid quantitative method in a swine paraquat poisoning model [J]. World Journal of Emergency Medicine, 2020, 11(3): 174-181.
[3]	Jia-jun Xu, Jian-tao Zhen, Li Tang, Qing-ming Lin. Intravenous injection of Xuebijing attenuates acute kidney injury in rats with paraquat intoxication [J]. World Journal of Emergency Medicine, 2017, 8(1): 61-64.
[4]	Qing-ming Lin, Xiang-shao Fang, Li-li Zhou, Yue Fu, Jun Zhu, Zi-tong Huang. Changes of end-tidal carbon dioxide during cardiopulmonary resuscitation from ventricular fibrillation versus asphyxial cardiac arrest [J]. World Journal of Emergency Medicine, 2014, 5(2): 116-121.
[5]	Shou-peng Li, Ji-yuan Han, Peng Sun, Guo-yan Wu, Xiang-yan Bai. Effect of SP-A/B in lipoic acid on acute paraquat poisoning [J]. World Journal of Emergency Medicine, 2014, 5(1): 57-62.
[6]	Xiao-xiao Meng, Rui-lan Wang, Shan Gao, Hui Xie, Jiu-ting Tan, Yong-bin Qian. Effect of ulinastatin on paraquat-induced-oxidative stress in human type II alveolar epithelial cells [J]. World Journal of Emergency Medicine, 2013, 4(2): 133-137.
[7]	Yin-song Jiang, Yu-ying Ma, Zhan-qing Wang, Guang-jun Li. Therapeutic effects of smecta or smectite powder on rats with paraquat toxication [J]. World Journal of Emergency Medicine, 2013, 4(2): 144-150.
[8]	Zhi-jian Zhang, Li-bo Peng, Ya-juan Luo, Cong-yang Zhou. Prospective experimental studies on the renal protective effect of ulinastatin after paraquat poisoning [J]. World Journal of Emergency Medicine, 2012, 3(4): 299-304.
[9]	Zhi-qiang Cheng, Ji-yuan Han, Peng Sun, Yu-ying Weng, Jiao Chen, Guo-yan Wu, Hong-xia Ma. Edaravone attenuates paraquat-induced lung injury by inhibiting oxidative stress in human type II alveolar epithelial cells [J]. World Journal of Emergency Medicine, 2012, 3(1): 55-59.
[10]	Jing Shi, Chun-lin Hu, Yu-feng Gao, Xiao-xing Liao, Hope Xu. The relationship between platelet endothelial cell adhesion molecule-1 and paraquat-induced lung injury in rabbits [J]. World Journal of Emergency Medicine, 2012, 3(1): 60-64.
[11]	Chang-bin Li, Xin-hua Li, Zhen Wang, Cheng-hua Jiang, Ai Peng. Serum paraquat concentration detected by spectrophotometry in patients with paraquat poisoning [J]. World Journal of Emergency Medicine, 2011, 2(3): 179-184.
[12]	Hui-li Zhang, Yuan-fei Liu, Xu-rui Luo, Wei-hua Tan, Liang Huang. Saturated hydrogen saline protects rats from acute lung injury induced by paraquat [J]. World Journal of Emergency Medicine, 2011, 2(2): 149-153.
[13]	Xiao-li Xu, Wei Wang, Zu-jun Song, Hong Ding, Xiao-hong Duan, Huan-cheng Meng, Jian Chong. Imaging in detecting sites of pulmonary fibrosis induced by paraquat [J]. World Journal of Emergency Medicine, 2011, 2(1): 45-49.
[14]	Ai-wen He, Ting Yang, Shou-quan Chen, Zhang-ping Li, Hui-ping Li, Wei-jia Huang, Jun-yan Cheng, Jie Zhang, Ping Yang, Wan-tie Wang. Effects of Hemin on neuroglobin expression after cardiopulmonary resuscitation in rats [J]. World Journal of Emergency Medicine, 2011, 2(1): 54-58.
[15]	Zhi-jian Zhang, Cong-yang Zhou, Ya-juan Luo, Hua-wei Xiong. Expression of heat shock protein 70 in lung tissues of acute paraquat poisoned rats and intervention of ulinastatin [J]. World Journal of Emergency Medicine, 2010, 1(3): 229-233.