TRAF6 polymorphisms not associated with the susceptibility to and severity of sepsis in a Chinese population

Abstract

Abstract:

BACKGROUND: The tumor necrosis factor recepter associated factor (TRAF) 6 is an important intracellular adapter protein that plays a pivotal role in activating multiple inflammatory and immune related processes induced by cytokines. TRAF6 represents a strong candidate susceptibility factor for sepsis. We investigated whether polymorphisms at the TRAF6 gene are associated with the susceptibility to and severity of sepsis.

METHODS: A hospital-based case-control study was conducted with 255 patients with sepsis and 260 controls who were recruited from Zhengzhou, China. Haplotype tagging single nucleotide polymorphisms (htSNPs) were selected from the HapMap database and genotyped using the SNPstream genotyping platform. The associations with the susceptibility and disease severity of sepsis were estimated by logistic regression, and adjusted for age, sex, smoking, drinking, chronic diseases status, APACHEII score and critical illness status.

RESULTS: A total of 13 TRAF6 SNPs were tagged by 7 htSNPs. Five htSNPs (rs5030490, rs5030411, rs5030416, rs5030445 and rs3740961) were genotyped in the case control study. Genotype frequencies of the htSNPs were conformed to the Hardy-Weinberg equilibrium in both patients and controls. No significant association was found between the 5 htSNPs and the susceptibility to and severity of sepsis. Compared with the main haplotype -11120A/-10688T/-9423A/805G/12967G, no certain haplotype was associated with the significantly susceptibility to or severity of sepsis.

CONCLUSION: TRAF6 gene polymorphisms might not play a major role in mediating the susceptibility to and severity of sepsis in the Chinese population. A larger population-based case-control study is warranted.

Key words: Sepsis, Tumor necrosis factor recepter associated factor 6, Haplotype tagging singlenucleotide polymorphisms, Linkage disequilibrium, Genetic association

Yu Fang, Lu Zhang, Gang-qiao Zhou, Zhi-fu Wang, Kai Feng, Zhi-yi Lou, Wei Pang, Lei Li, Yan Ling, Yu-xia Li, Bao-chi Liu. TRAF6 polymorphisms not associated with the susceptibility to and severity of sepsis in a Chinese population[J]. World Journal of Emergency Medicine, 2010, 1(3): 169-175.

Figures/Tables 4

Figure 1.

Table 1

Table 2

Table 3

The distribution of TRAF6 polymorphisms genotype in the controls and patients with different disease severity and adjusted OR for sepsis risk

SNP	Genotype	Control n (%)	Case n (%)	* Disease severity n (%)			#OR (95%CI)				# P value
SNP	Genotype	Control n (%)	Case n (%)	G1	G2	G3	A	B	C	D	A	B	C	D
rs 5030490	A/A	204 (78.5)	205 (80.4)	36 (81.8)	100 (80.7)	15 (79)	1	1	1	1
	G/A	53 (20.4)	44 (17.2)	6 (13.6)	22 (17.7)	3 (15.8)	0.88 (0.55-1.41)	0.88 (0.28-2.79)	1.05 (0.44-2.51)	0.55 (0.07-4.18)	0.233	0.385	0.31	0.385
	G/G	3 (1.1)	6 (2.4)	2 (4.5)	2 (1.6)	1 (5.3)	2.14 (0.51-8.97)	3.60 (0.39-33.14)	0.24 (0.02-2.80)	2.59 (0.12-55.50)	0.261	0.435	0.249	0.435
rs 5030411	T/T	119 (46.1)	121 (47.5)	18 (40.9)	60 (48.4)	6 (31.6)	1	1	1	1
	T/C	120 (46.5)	113 (44.3)	23 (52.3)	54 (43.5)	11 (57.9)	0.85 (0.57-1.25)	1.19 (0.51-2.80)	0.64 (0.32-1.25)	1.80 (0.44-7.47)	0.297	0.745	0.631	0.982
	C/C	19 (7.4)	21 (8.2)	3 (6.8)	10 (8.1)	2 (10.5)	1.15 (0.57-2.31)	1.04 (0.23-4.69)	0.59 (0.18-1.95)	3.16 (0.39-25.31)	0.51	0.945	0.61	0.381
rs 5030416	A/A	189 (73.3)	182 (72.2)	32 (74.4)	89 (72.4)	14 (73.7)	1	1	1	1
	C/A	66 (25.6)	65 (25.8)	10 (23.3)	31 (25.2)	4 (21.1)	0.96 (0.63-1.46)	0.62 (0.23-1.66)	0.76 (0.37-1.58)	0.83 (0.16-4.21)	0.514	0.469	0.359	0.149
	C/C	3 (1.2)	5 (2)	1 (2.3)	3 (2.4)	1 (5.3)	1.58 (0.36-6.86)	1.15 (0.10-13.11)	1.80 (0.22-14.58)	12.45 0.76-204.26)	0.523	0.763	0.496	0.061
rs 5030445	G/G	177 (68.9)	186 (73.5)	31 (70.5)	93 (75.6)	11 (57.9)	1	1	1	1
	G/A	77 (30)	58 (22.9)	11 (25)	25 (20.3)	7 (36.8)	0.79 (0.52-1.21)	1.09 (0.39-3.06)	0.52 (0.23-1.19)	1.30 (0.28-5.91)	0.057	0.895	0.352	0.886
	A/A	3 (1.2)	9 (3.6)	2 (4.5)	5 (4.1)	1 (5.3)	2.77 (0.71-10.76)	1.42 (0.21-9.64)	0.81 (0.14-4.80)	1.29 (0.10-17.37)	0.101	0.753	0.898	0.926
rs 3740961	G/G	55 (21.3)	66 (25.9)	13 (29.6)	37 (29.8)	5 (26.3)	1	1	1	1
	G/A	147 (57)	133 (52.2)	23 (52.3)	63 (50.8)	10 (52.6)	0.78 (0.49-1.24)	0.68 (0.27-1.74)	0.81 (0.38-1.75)	0.64 (0.14-2.93)	0.327	0.687	0.881	0.557
	A/A	56 (21.7)	56 (22)	8 (18.2)	24 (19.4)	4 (21.1)	0.88 (0.51-1.53)	0.65 (0.20-2.12)	0.59 (0.23-1.51)	0.96 (0.15-6.14)	0.993	0.653	0.301	0.832

Table 3

References 24

1	Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, et al. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. Chest 1992; 101:1644-1655. doi: 10.1378/chest.101.6.1644 pmid: 1303622
2	Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, et al. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest 2009; 136:e28. doi: 10.1378/chest.09-2267
3	Angus DC, Linde-Zwirble WT, Lidicker L, Clermont G, Carcillo J, Pinsky MR. Epidemiology of severe sepsis in the United States: analysis of incidence, outcome, and associated costs of care. Crit Care Med 2001; 29:1303-1310. pmid: 11445675
4	Annane D, Aegerter P, Jars-Guincestre MC, Guidet B, CUB-Rea Network. Current epidemiology of septic shock. Am J Respir Crit Care Med 2003; 168:165-172. pmid: 12851245
5	Bernard GR, Vincent JL, Laterre PF, LaRosa SP, Dhainaut JF, Lopez-Rodriguez A, et al. Efficacy and safety of recombinant human activated protein C for severe sepsis. N Engl J Med 2001; 344:699-709. pmid: 11236773
6	Annane D, Aegerter P, Jars-Guincestre MC, Guidet B. Current epidemiology of septic shock: the CUB-Rea Network. Am J Respir Crit Care Med 2003; 168:165-172. pmid: 12851245
7	Kumpf O, Schumann RR. Genetic influence on bloodstream infections and sepsis. Int J Antimicrob Agents 2008; 32:S44-50. doi: 10.1016/j.ijantimicag.2008.08.002 pmid: 18849152
8	Cheng B, Xie G, Yao S, Wu X, Guo Q, Gu M, et al. Epidemiology of severe sepsis in critically ill surgical patients in ten university hospitals in China. Crit Care Med 2007; 35:2538-2546. pmid: 17828034
9	Gao H, Evans TW, Finney SJ. Bench-to-bedside review: sepsis, severe sepsis and septic shock - does the nature of the infecting organism matter? Crit Care 2008; 12:213. pmid: 18466647
10	Villar J, Maca-Meyer N, Pérez-Méndez L, Flores C. Bench-to-bedside review: Understanding genetic predisposition to sepsis. Crit Care 2004; 8:180-189. doi: 10.1186/cc2863 pmid: 15153236
11	Cohen J. The immunopathogenesis of sepsis. Nature 2002; 420:885-891. doi: 10.1038/nature01326 pmid: 12490963
12	Clark MF, Baudouin SV. A systematic review of the quality of genetic association studies in human sepsis. Intensive Care Med 2006; 32:1706-1712. pmid: 16957907
13	Schuetz P, Christ-Crain M, Muller B. Biomarkers to improve diagnostic and prognostic accuracy in systemic infections. Curr Opin Crit Care 2007; 13:578-585. doi: 10.1097/MCC.0b013e3282c9ac2a pmid: 17762239
14	Wurfel MM. Genetic insights into sepsis: what have we learned and how will it help? Curr Pharm Des 2008; 14:1900-1911. doi: 10.2174/138161208784980554 pmid: 18691101
15	Takashi K, Matthew CW, Choi YW. The role of TRAF6 in signal transduction and the immune response. Microbes and Infection 2004; 6:1333-1338. doi: 10.1016/j.micinf.2004.09.001
16	Twomey C, Qian S, McCarthy JV. TRAF6 promotes ubiquitination and regulated intramembrane proteolysis of IL-1R1. Biochemical and Biophysical Research Communications 2009; 381:418-423. doi: 10.1016/j.bbrc.2009.02.051 pmid: 19232518
17	Lee MS, Kim YJ. Signaling pathways downstream of pattern-recognition receptors and their cross talk. Annu Rev Biochem 2007; 76:447-480. pmid: 17328678
18	Underhill DM, Ozinsky A. Toll-like receptors: key mediators of microbe detection. Current Opinion in Immunology 2002; 14:103-110. doi: 10.1016/S0952-7915(01)00304-1
19	Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, et al. 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Crit Care Med 2003; 31:1250-1256. doi: 10.1097/01.CCM.0000050454.01978.3B pmid: 12682500
20	Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification system. Crit Care Med 1985; 13:818-829. pmid: 3928249
21	Bell PA, Chaturvedi S, Gelfand CA, Huang CY, Kochersperger M, Kopla R, et al. SNPstream UHT: Ultra-high throughput SNP genotyping for pharmacogenomics and drug discovery. Bio Techniques 2003; 34:496.
22	Gohda J, Matsumura T, Inoue J. Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domainYcontaining adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling. J Immunol 2004; 173:2913-2917. doi: 10.4049/jimmunol.173.5.2913 pmid: 15322147
23	Slotta JE, Scheuer C, Menger MD, Vollmar B. Immunostimulatory CpG-oligodeoxynucleotides (CpG-ODN) induce early hepatic injury, but provide a late window for protection against endotoxin-mediated liver damage. J Hepatol 2006; 44:576-585. doi: 10.1016/j.jhep.2005.08.014 pmid: 16310279
24	Hull C, McLean G, Wong F, Duriez PJ, Karsan A. Lipopolysaccharide signals an endothelial apoptosis pathway through TNF receptor-associated factor 6-mediated activation of c-Jun NH2-terminal kinase. J Immunol 2002; 169:2611-2618. doi: 10.4049/jimmunol.169.5.2611 pmid: 12193732

SNP	Primer	Length of PCR production(bp)	Sequence 5'-3'
rs2569193-2839C>T	Forward (PCRU)	151	AGCCCTGTACAAGACAGGAC
	Reverse (PCRL)		AAGATGAAAAAAGTTCCCAGC
	Probe (SNPU)		GACCTGGGTGTCGATACCTAATATTCTGCCCAGTGTCTGCTCAGA
rs5744455 -651C>T	Forward (PCRU)	90	CAAAGGAGCAAGGAAAAAAA
	Reverse (PCRL)		TTGGCACCAAGGGGGGTA
	Probe (SNPU)		CGTGCCGCTCGTGATAGAATAGGAAGGGGGAATTTTTCTTTAGAC
rs2569190-260C>T	Forward (PCRU)	121	CAGGAAAGGAAGGGGGCT
	Reverse (PCRL)		GGCAGTGTCCTGATGACTCA
	Probe (SNPL)		CCCCCTCCCTGAAACATCCTTCATTAAGCATTGCGAATCATAGCC

Variable	Cases (n = 255)	Controls (n = 260)	P value
Men, No. (%)	168 (65.9)	171 (65.8)	1^a
Age (y) mean (SD)	45.8 (17.6)	45.3 (15.9)	0.83^b
Smokers, No. (%)	96 (37.6)	44 (16.9)	< 0.001^a
Drinkers, No. (%)	70 (27.5)	16 (6.2)	< 0.001^a
Chronic comorbidities, No. (%)^c
Diabetes	19 (7.3)	3 (1.6)	0.080^a
Hypertension	12 (4.6)	9 (3.5)	0.504^a
Ischemic cardiopathy	6 (2.3)	7 (2.7)	0.779^a
HBV carriers, No. (%)	11 (4.2)	5 (1.9)	0.128^a
Disease severity, No. (%)
Sepsis	129 (50.6)
Severe sepsis	65 (25.5)
Septic shock	21 (8.2)
MODS	21 (8.2)
Death from spesis	19 (7.5)
APACHE II score
Median (range of values)	15.54 (5-42)
Site of infection, No. (%)
Abdominal	216 ( 83.1)
Pulmonary	23 (8.8)
Others	21 (8.1)
Pathogen, No. (%)	86
Gram negative	62 (72.1)
Gram positive	20 (23.6)
Fungi	2 (2.3)
Mixed infection	3 (3.5)

[1]	Li-wei Duan, Jin-long Qu, Jian Wan, Yong-hua Xu, Yi Shan, Li-xue Wu, Jin-hao Zheng, Wei-wei Jiang, Qi-tong Chen, Yan Zhu, Jian Zhou, Wen-bo Yu, Lei Pei, Xi Song, Wen-fang Li, Zhao-fen Lin. Effects of viral infection and microbial diversity on patients with sepsis: A retrospective study based on metagenomic next-generation sequencing [J]. World Journal of Emergency Medicine, 2021, 12(1): 29-35.
[2]	Hai-jiang Zhou, Tian-fei Lan, Shu-bin Guo. Outcome prediction value of National Early Warning Score in septic patients with community-acquired pneumonia in emergency department: A single-center retrospective cohort study [J]. World Journal of Emergency Medicine, 2020, 11(4): 206-215.
[3]	Yu-ming Wang, Yan-jun Zheng, Ying Chen, Yun-chuan Huang, Wei-wei Chen, Ran Ji, Li-li Xu, Zhi-tao Yang, Hui-qiu Sheng, Hong-ping Qu, En-qiang Mao, Er-zhen Chen. Effects of fluid balance on prognosis of acute respiratory distress syndrome patients secondary to sepsis [J]. World Journal of Emergency Medicine, 2020, 11(4): 216-222.
[4]	Miao Yuan, Ding-yi Yan, Fang-shi Xu, Yi-di Zhao, Yang Zhou, Long-fei Pan. Effects of sepsis on hippocampal volume and memory function [J]. World Journal of Emergency Medicine, 2020, 11(4): 223-230.
[5]	Wen-peng Yin, Jia-bao Li, Xiao-fang Zheng, Le An, Huan Shao, Chun-sheng Li. Effect of neutrophil CD64 for diagnosing sepsis in emergency department [J]. World Journal of Emergency Medicine, 2020, 11(2): 79-86.
[6]	Shao-hua Liu, Huo-yan Liang, Hong-yi Li, Xian-fei Ding, Tong-wen Sun, Jing Wang. Effect of low high-density lipoprotein levels on mortality of septic patients: A systematic review and meta-analysis of cohort studies [J]. World Journal of Emergency Medicine, 2020, 11(2): 109-116.
[7]	Yi-wen Fan, Shao-wei Jiang, Jia-meng Chen, Hui-qi Wang, Dan Liu, Shu-ming Pan, Cheng-jin Gao. A pulmonary source of infection in patients with sepsis-associated acute kidney injury leads to a worse outcome and poor recovery of kidney function [J]. World Journal of Emergency Medicine, 2020, 11(1): 18-26.
[8]	Kimberly A. Chambers, Adam Y. Park, Rosa C. Banuelos, Bryan F. Darger, Bindu H. Akkanti, Annamaria Macaluso, Manoj Thangam, Pratik B. Doshi. Outcomes of severe sepsis and septic shock patients after stratification by initial lactate value [J]. World Journal of Emergency Medicine, 2018, 9(2): 113-117.
[9]	Muhammad Akbar Baig, Hira Shahzad, Erfan Hussain, Asad Mian. Validating a point of care lactate meter in adult patients with sepsis presenting to the emergency department of a tertiary care hospital of a low- to middle-income country [J]. World Journal of Emergency Medicine, 2017, 8(3): 184-189.
[10]	Chao Cao, Tao Ma, Yan-fen Chai, Song-tao Shou. The role of regulatory T cells in immune dysfunction during sepsis [J]. World Journal of Emergency Medicine, 2015, 6(1): 5-9.
[11]	Kun Chen, Qiu-xiang Zhou, Hong-wei Shan, Wen-fang Li, Zhao-fen Lin. Prognostic value of CD4⁺CD25⁺ Tregs as a valuable biomarker for patients with sepsis in ICU [J]. World Journal of Emergency Medicine, 2015, 6(1): 40-43.
[12]	Hui Fu, Qiao-sheng Wang, Qiong Luo, Si Tan, Hua Su, Shi-lin Tang, Zheng-liang Zhao, Li-ping Huang. Simvastatin inhibits apoptosis of endothelial cells induced by sepsis through upregulating the expression of Bcl-2 and downregulating Bax [J]. World Journal of Emergency Medicine, 2014, 5(4): 291-297.
[13]	Qi Zou, Wei Wen, Xin-chao Zhang. Presepsin as a novel sepsis biomarker [J]. World Journal of Emergency Medicine, 2014, 5(1): 16-19.
[14]	Nishant Raj Pandey, Yu-yao Bian, Song-tao Shou. Significance of blood pressure variability in patients with sepsis [J]. World Journal of Emergency Medicine, 2014, 5(1): 42-47.
[15]	Huan Ding, Xiang-yuan Cao, Xi-gang Ma, Wen-jie Zhou. Endothelial cell injury with inflammatory cytokine and coagulation in patients with sepsis [J]. World Journal of Emergency Medicine, 2013, 4(4): 285-289.