Autophagy inhibitor 3-methyladenine regulates the expression of LC3, Beclin-1 and ZnTs in rat cerebral cortex following recurrent neonatal seizures

Abstract

Abstract:

BACKGROUND: Autophagy is a homeostatic process for intracellular recycling of bulk proteins and aging organelles. Increased autophagy has now been reported in experimental models of traumatic brain injury, stroke and excitotoxicity, and in patients with Alzheimer's disease and critical illness. The role of autophagy in developmental epilepsy, however, is unknown. The present study was to investigate the effects of recurrent neonatal seizure, in the presence and absence of autophagy inhibitor 3-methyladenine (3-MA), on the acute phase gene expression of ZnTs, LC3 and Beclin-1 in rat cerebral cortex and the interaction among them.

METHODS: Thirty-six Sprague-Dawley neonatal rats at postnatal day 6(P6) were randomly divided into three groups: a recurrent-seizures group (RS, n=12), a 3-MA treated-seizure group (3-MA group, each rat pretreated with 3-methyladenine before seizures, 100nmol/μl/day, i.p., n=12) and a control group (n=12). At 1.5 and 6 hours after the last seizures, the mRNA levels of ZnT1-ZnT3, microtubule-associated protein 1A/1B light chain 3 (LC3) and beclin-1 were detected using the real-time RT-PCR method. The LC3 protein level was examined by Western blotting.

RESULTS: The levels of LC3, beclin-1 and ZnT-2 transcripts in the RS group elevated significantly at 1.5 and 6 hours after the last seizures compared with those in the control and 3-MA groups. At the interval of 1.5 hours, the mRNA level of ZnT-1 increased significantly after the last seizure compared with that in the control group. There was no significant difference in the transcript levels of ZnT-3 among the three groups. Linear correlation analysis showed that the expression of the five genes in the control group exhibited a significant inter-relationship. In the 3-MA group, however, the inter-relationship was only found between beclin-1 and ZnT-1. In the RS group, the inter-relationship was not observed.

CONCLUSIONS: The autophagy/lysosomal pathway is immediately activated along with the elevated expression of ZnT1 and ZnT2 in the cerebral cortex after recurrent seizures. 3-MA is involved in the regulation of the autophagy/lysosomal pathway and ZnTs by down-regulating the expression of LC3 and beclin-1.

Key words: Zinc transporter 1, Zinc transporter 3, LC3, Beclin-1, Seizure

Hong Ni, Yong Gong, Jian-zhen Yan, Le-ling Zhang. Autophagy inhibitor 3-methyladenine regulates the expression of LC3, Beclin-1 and ZnTs in rat cerebral cortex following recurrent neonatal seizures[J]. World Journal of Emergency Medicine, 2010, 1(3): 216-223.

Figures/Tables 4

Table 1

Figure 1.

Figure 2.

Figure 3.

References 34

1	Ben-Ari Y, Holmes GL. Effects of seizures on developmental processes in the immature brain. Lancet Neurol 2006; 5:1055-1063. doi: 10.1016/S1474-4422(06)70626-3 pmid: 17110286
2	Holmes GL. Effects of seizures on brain development: lessons from the laboratory. Pediatr Neurol 2005; 33:1-11. doi: 10.1016/j.pediatrneurol.2004.12.003 pmid: 15993318
3	Holopainen IE. Seizures in the developing brain: cellular and molecular mechanisms of neuronal damage, neurogenesis and cellular reorganization. Neurochem Int 2008; 52:935-947. doi: 10.1016/j.neuint.2007.10.021 pmid: 18093696
4	Missuya K, Nitta N, Suzuki F. Persistent zinc depletion in the mossy fiber terminals in the intrahippocampal kainite mouse model of mesial temporal lobe epilepsy. Epilepsia 2009; 50:1979-1990. doi: 10.1111/j.1528-1167.2009.02055.x pmid: 19389150
5	Nakashima AS, Dyck RH. Zinc and cortical plasticity. Brain. Res Rev 2009; 59:347-373. pmid: 19026685
6	Paoletti P, Vergnano AM, Barbour B, Casado M. Zinc at glutamatergic synapses. Neurosci 2009; 158:126-136.
7	Siddiqui AH, Joseph SA. CA3 axonal sprouting in kainite-induced chronic epilepsy. Brain Res 2005; 1066:129-146. pmid: 16359649
8	McAuliffe JJ, Bronson SL, Hester MS, Murphy BL, Dahlquist-Topala R, Richards DA, et al. Altered patterning of dentate granule cell mossy fiber inputs onto CA3 pyramidal cells in limbic epilepsy. Hippocampus 2010 (Epub ahead of print). pmid: 33037862
9	Danzer SC, He X, Loepke AW, McNamara JO. Structural plasticity of dentate granule cell mossy fibers during the development of limbic epilepsy. Hippocampus 2010; 20:113-124. pmid: 19294647
10	Devirgiliis C, Zalewski PD, Perozzi G, Murgia C. Zinc fluxes and zinc transporter genes in chronic diseases. Mutat Res 2007; 622:84-93. pmid: 17374385
11	Chimienti F, Aouffen M, Favier A, Seve M. Zinc homeostasis-regulating proteins: new drug targets for triggering cell fate. Curr Drug Targets 2003; 4:323-338. doi: 10.2174/1389450033491082 pmid: 12699353
12	Sensi SL, Jeng JM. Rethinki right part of the ng the excitotoxic ionic milieu: the emerging role of Zn²⁺ in ischemic neuronal injury. Curr Mol Med 2004; 4:87-111. doi: 10.2174/1566524043479211 pmid: 15032707
13	Sutula TP, Dudek FE. Unmasking recurrent excitation generated by mossy fiber sprouting in the epileptic dentate gyrus: an emergent property of a complex system. Prog Brain Res 2007; 163:541-563. doi: 10.1016/S0079-6123(07)63029-5 pmid: 17765737
14	Colvin RA, Bush AI, Volitakis I, Fontaine CP, Thomas D, Kikuchi K, et al. Insights into Zn²⁺ homeostasis in neurons from experimental and modeling studies. Am J Physiol Cell Physiol 2008; 294:C726-742. doi: 10.1152/ajpcell.00541.2007 pmid: 18184873
15	Williams BL, Yaddanapudi K, Kirk CM, Soman A, Hornig M, Lipkin WI. Metallothioneins and zinc dysregulation contribute to neurodevelopmental damage in a model of perinatal viral infection. Brain Pathol 2006; 16:1-14. doi: 10.1111/j.1750-3639.2006.tb00556.x pmid: 16612977
16	Linkous DH, Flinn JM, Koh JY. Evidence that the ZNT3 protein controls the total amount of elemental zinc in synaptic vesicles. J Histochem Cytochem 2008; 56:3-6. doi: 10.1369/jhc.6A7035.2007 pmid: 17712179
17	Ni H, Jiang YW, Tao LY, Jin MF, Wu XR. ZnT-1, ZnT-3, CaMKII, PRG-1 expressions in hippocampus following neonatal seizure-induced cognitive deficit in rats. Toxico Lett 2009; 184:145-150. doi: 10.1016/j.toxlet.2008.11.003
18	Ni H, Jiang YW, Tao LY, Cen JN, Wu XR. Effects of penicillin-induced developmental epilepticus on hippocampal regenerative sprouting, related gene expression and cognitive deficits in rats. Toxico Lett 2006; 188:161-166. doi: 10.1016/j.toxlet.2009.04.002
19	Ni H, Jiang YW, Xiao ZJ, Tao LY, Jin MF, Wu XR. Dynamic pattern of gene expression of ZnT-1, ZnT-3 and PRG-1 in rat brain following flurothyl-induced recurrent neonatal seizures. Toxicol Lett 2010; 194:86-93 doi: 10.1016/j.toxlet.2010.02.008 pmid: 20167268
20	Wang Y, Han R, Liang ZQ, Wu JC, Zhang XD, Gu ZL, et al. An autophagic mechanism is involved in apoptotic death of rat striatal neurons induced by the non-N-methyl-D-aspartate receptor agonist kainic acid. Autophagy 2008; 4:214-226. doi: 10.4161/auto.5369 pmid: 18094625
21	Au AK, Bayir H, Kochanek PM, Clark RSB. Evaluation of autophagy using mouse models of brain injury. Biochim Biophys Acta 2010; 1802:918-923. Epub 2009 Oct 30. doi: 10.1016/j.bbadis.2009.10.010 pmid: 19879944
22	de Roqalski Landrot I, Minokoshi M, Silveira DC, Cha BH, Holmes GL. Recurrent neonatal seizures: relationship of pathology to the electroencephalogram and cognition. Brain Res Dev Brain Res 2001; 129:27-38. doi: 10.1016/s0165-3806(01)00177-8 pmid: 11454410
23	Johnson MR, Wang K, Smith JB, Heslin MJ, Diasio RB. Quantitation of dihydropyrimidine dehydrogenase expression by real-time reverse transcription polymerase chain reaction. Anal Biochem 2000; 278:175-184. doi: 10.1006/abio.1999.4461 pmid: 10660460
24	Beharier O, Etzion Y, Katz A, Friedman H, Tenbosh N, Zacharish S, et al. Crosstalk between L-type calcium channels and ZnT-1, a new player in rate-dependent cardiac electrical remodeling. Cell Calcium 2007; 42:71-82. doi: 10.1016/j.ceca.2006.11.007
25	Cousins RJ, Liuzzi JP, Lichten LA. Mammalian zinc transport, trafficking, and signals. J Biol Chem 2006; 281:24085-24089. doi: 10.1074/jbc.R600011200 pmid: 16793761
26	Palmiter RD, Cole TB, Findley SD. ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vesicular sequestration. EMBO J 1996; 15:1784-1791. pmid: 8617223
27	Wenzel HJ, Cole TB, Born DE, Schwartzkroin PA, Palmiter RD. Ultrastructural localization of zinc transporter-3 (ZnT-3) to synaptic vesicle membranes within mossy fiber boutons in the hippocampus of mouse and monkey. Proc Natl Acad Sci USA 1997; 94:12676-12681. doi: 10.1073/pnas.94.23.12676 pmid: 9356509
28	Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirsako T, Noda T, et al. LC3, a mammalian homologue of yeast Apg8p, is located in autophagosome membranes after processing. EMBO J 2000; 19:5720-5728. doi: 10.1093/emboj/19.21.5720 pmid: 11060023
29	Kihara A, Kabeya Y, Ohsumi Y, Yoshimori T. Beclin-phosphatidylinositol 3- kinase complex functions at the trans-Golgi network. EMBO Rep 2001; 2:330-335. doi: 10.1093/embo-reports/kve061 pmid: 11306555
30	Diskin T, Tal-Or P, Erlich S, Mizrachy L, Alexandrovich A, Shohami E, et al. Closed head injury induces upregulation of Beclin 1 at the cortical site of injury. J Neurotrauma 2005; 22:750-762. doi: 10.1089/neu.2005.22.750 pmid: 16004578
31	Yan L, Sadoshima J, Vatner DE, Vatner SF. Autophagy: a novel protective mechanism in chronic ischemia. Cell Cycle 2006; 5:1175-1177. pmid: 16760663
32	Rami A, Langhagen A, Steiger S. Focal cerebral ischemia induces upregulation of Beclin 1 and autophagy-like cell death. Neurobiol Dis 2008; 29:132-141. doi: 10.1016/j.nbd.2007.08.005 pmid: 17936001
33	Carloni S, Buonocore G, Balduini W. Protective role of autophagy in neonatal hypoxia-ischemia induced brain injury. Neurobio Dis 2008; 32:329-339. doi: 10.1016/j.nbd.2008.07.022
34	Hirosako K, Imasato H, Hirota Y, Kuronita T, Masuyama N, Nishioka M, et al. 3-methyladenine specifically inhibits retrograde transport of cation-independent mannose 6-phosphate/insulin- like growth factor II receptor from the early endosome to the TGN. Biochem Biophys Res Commun 2004; 316:845-852. doi: 10.1016/j.bbrc.2004.02.119 pmid: 15033478

Gene	Genbank accession number	Primer sequence	No.of cycles
LC-3	NM_012823	F: 5'-CCTGCTGCTGGCCGTAGT-3' R: 5'-TGATGAAGTCTTCCTGCCAAAA-3' probe:- 5'-FAM-CGCTGTACGAGGAACACCCCAGCT-TAMRA-3'	45
Beclin-1	NM_001034117	F: 5'-AGCACGCCATGTATAGCAAAGA-3' R: 5'-GGAAGAGGGAAAGGACAGCAT-3' probe:- 5'-FAM-CCCTGCCGTAGTTTGGCTCAACCC-TAMRA-3'	45
ZnT-1	NM_022853	F: 5'- CGTTGTTGTGAATGCCTTGGT-3' R:5'-GGGTTCACACAAAAGTCGTCTTC-3' probe::5'-FAM-TTCTACTTTTCCTGGAAGGGTTGTA-TAMRAM-3'	45
ZnT-2	RNU50927	F: 5'- GGCTGGATCCTGGACTAATGTT -3' R: 5'- ACACCCCAAAATCCCTTTCTG -3' probe:5'-FAM-CTCACACCACAGCTGGAGAGACACTGAGG-TAMRA-3'	45
ZnT-3	NM_001013243	F:5'- TGGGCGCTGACGCTTACT-3' R: 5'- GTCAGCCGTGGAGTCAATAGC-3' probe::5'-FAM-ACCACGTTGCCTCCGCACACCT-TAMRAM-3'	45

[1]	Gholamreza Sadeghipoor Roodsari, Geetha Chari, Bryan Mera, Shahriar Zehtabchi. Can patients with non-convulsive seizure be identified in the emergency department? [J]. World Journal of Emergency Medicine, 2017, 8(3): 190-194.
[2]	Assadollahi Marjan, Ramezani Mahtab, Karimialavijeh Ehsan, Mirfazaelian Hadi. Generalized seizure, the only manifestation of a small ischemic atherothrombotic infarction [J]. World Journal of Emergency Medicine, 2016, 7(1): 71-73.
[3]	Jian Lu, Yi Shen, Hui-yin Qian, Li-jun Liu, Bao-chun Zhou, Yan Xiao, Jin-ning Mao, Guo-yin An, Ming-zhong Rui, Tao Wang, Chang-lai Zhu. Effects of mild hypothermia on the ROS and expression of caspase-3 mRNA and LC3 of hippocampus nerve cells in rats after cardiopulmonary resuscitation [J]. World Journal of Emergency Medicine, 2014, 5(4): 298-305.
[4]	Turgay Yılmaz Kılıc, Murat Yesilaras, Ozge Duman Atilla, Mustafa Sever, Ersin Aksay. Can venous blood gas analysis be used for predicting seizure recurrence in emergency department? [J]. World Journal of Emergency Medicine, 2014, 5(3): 187-191.