Relationships between genetic polymorphisms of triggering receptor expressed on myeloid cells-1 and septic shock in a Chinese Han population

doi:10.5847/wjem.j.1920-8642.2015.02.007

Abstract

Abstract:

BACKGROUND: Triggering receptor expressed on myeloid cells-1 (TREM-1) is a cell surface receptor expressed on neutrophils and monocytes. TREM-1 acts to amplify inflammation and serves as a critical mediator of inflammatory response in the context of sepsis. To date, the predisposition of TREM-1 gene polymorphisms to septic shock has not been reported. This study was designed to investigate whether TREM-1 genomic variations are associated with the development of septic shock.
METHODS: We genotyped two TREM-1 single nucleotide polymorphisms (SNPs, rs2234237 and rs2234246) and evaluated the relationships between these SNPs and septic shock on susceptibility and prognosis.
RESULTS: TREM-1 rs2234246 A allele in the promoter region was significantly associated with the susceptibility of septic shock in recessive model (AA, OR=3.10, 95%CI 1.15 to 8.32, P=0.02), and in codominant model (AG, OR=0.72, 95%CI 0.43-1.19, P=0.02; AA, OR=2.71, 95%CI 1.00-7.42; P=0.03). However, in three inherited models (dominant model, recessive model, and codominant model), none of the assayed loci was significantly associated with the prognosis of septic shock. The non-survivor group demonstrated higher plasma IL-6 levels (99.7±34.7 pg/mL vs. 61.2±26.5 pg/mL, P<0.01) than the survivor group. Plasma concentrations of IL-6 among the three genotypes of rs2234246 were AA 99.4±48.9 pg/mL, AG 85.4±43 pg/mL, and GG 65.3±30.7 pg/mL (P<0.01). The plasma concentrations of IL-6 in patients with AA genotypes were significantly higher than those in patients with GG genotypes (P<0.01).
CONCLUSION: TREM-1 genetic polymorphisms rs2234246 may be significantly correlated only with susceptibility to septic shock in the Chinese Han population.

Key words: Triggering receptor expressed on myeloid cells-1, Single nucleotide polymorphisms, Septic shock, Association study

Liang-shan Peng, Juan Li, Gao-sheng Zhou, Lie-hua Deng, Hua-guo Yao. Relationships between genetic polymorphisms of triggering receptor expressed on myeloid cells-1 and septic shock in a Chinese Han population[J]. World Journal of Emergency Medicine, 2015, 6(2): 123-130.

Figures/Tables 9

Table 1

Table 2

Table 3

Table 4

Table 5

Table 6

Figure 1.

Figure 2.

Table 7

References 32

1	Sands KE, Bates DW, Lanken PN, Graman PS, Hibberd PL, Kahn KL, et al. Epidemiology of sepsis syndrome in 8 academic medical centers. JAMA 1997; 278:234-240. pmid: 9218672
2	Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med 2003; 348:138-150.
3	Dunn DL. Gram-negative bacterial sepsis and sepsis syndrome. Surg Clin North Am 1994; 74:621-635. pmid: 8197534
4	Tsiotou AG, Sakorafas GH, Anagnostopoulos G, Bramis J. Septic shock: current pathogenetic concepts from a clinical perspective. Med Sci Monit 2005; 11: RA76-85 pmid: 15735579
5	Annane D, Bellissant E, Cavaillon JM. Septic shock. Lancet 2005; 365:63.
6	Russell JA. Management of sepsis. N Engl J Med 2006; 355:1699. pmid: 17050894
7	Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J Med 2003; 348:138. pmid: 12519925
8	Bouchon A, Dietrich J, Colonna M. Cutting edge: Inflammatory responses can be triggered by TREM-1, a novel receptor expressed on neutrophils and monocytes. J Immunol 2000; 164:4991. doi: 10.4049/jimmunol.164.10.4991
9	Klesney-Tait J, Turnbull IR, Colonna M. The TREM receptor family and signal integration. Nat Immunol 2006; 7:1266.
10	Colonna M, Facchetti F. TREM-1 (triggering receptor expressed on myeloid cells): a new player in acute inflammatory responses. J Infect Dis 2003; 187(Suppl 2):S397-401.
11	Radaev S, Kattah M, Rostro B, Colonna M, Sun PD. Crystal structure of the human myeloid cell activating receptor TREM-1. Structure (Camb) 2003; 11:1527-1535.
12	Liu N, Gu Q, Zheng YS. Expression of triggering receptor-1 in myeloid cells of mice with acute lung injury. World J Emerg Med 2010; 1:144-148. pmid: 25214958
13	Bouchon A, Facchetti F, Weigand MA, Colonna M. TREM-1 amplifies inflammation and is a crucial mediator of septic shock. Nature 2001; 410:1103.
14	Chang RM, Wen LQ, Chang JX, Fu YR, Jiang ZP, Chen S. Repair of damaged intestinal mucosa in a mouse model of sepsis. World J Emerg Med 2013; 4:223-228. doi: 10.5847/wjem.j.issn.1920-8642.2013.03.012 pmid: 25215123
15	Gibot S, Cravoisy A, Kolopp-Sarda MN, Béné MC, Faure G, Bollaert PE, et al. Time-course of sTREM (soluble triggering receptor expressed on myeloid cells)-1, procalcitonin, and C-reactive protein plasma concentrations during sepsis. Crit Care Med 2005; 33:792.
16	Michalek J, Svetlikova P, Fedora M, Klimovic M, Klapacova L, Bartosova D, et al. Interleukin-6 gene variants and the risk of sepsis development in children. Hum Immunol 2007; 68:756-760. pmid: 17869650
17	Michalek J, Svetlikova P, Fedora M, Klimovic M, Klapacova L, Bartosova D, et al. Bactericidal permeability increasing protein gene variants in children with sepsis. Intensive Care Med 2007; 33:2158-2164.
18	Chen QX, Lv C, Huang LX, Cheng BL, Xie GH, Wu SJ, et al. Genomic variations within DEFB1 are associated with the susceptibility to and the fatal outcome of severe sepsis in Chinese Han population. Genes Immun 2007; 8:439-443.
19	Arcaroli J, Silva E, Maloney JP, He Q, Svetkauskaite D, Murphy JR, et al. Variant IRAK-1 haplotype is associated with increased nuclear factor-kappa B activation and worse outcomes in sepsis. Am J Respir Crit Care Med 2006; 173:1335-1341.
20	Walley KR, Russell JA. Protein C -1641 AA is associated with decreased survival and more organ dysfunction in severe sepsis. Crit Care Med 2007; 35:12-17.
21	Members of the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference: Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. Crit Care Med 1992; 20:864. pmid: 1597042
22	Levy MM, Fink MP, Marshall JC, Abraham E, Angus D, Cook D, et al. SCCM/ESICM/ACCP/ATS/SIS, 2001SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Crit Care Med 2003; 31:1250. pmid: 12682500
23	Xiao Z, Xiao J, Jiang Y, Zhang S, Yu M, Zhao J, et al. A novel method based on ligase detection reaction for low abundant YIDD mutants detection in hepatitis B virus. Hepatol Res 2006; 34:150-155.
24	Sole X, Guino E, Valls J, Iniesta R, Moreno V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 2006; 22:1928.
25	Barrett JC, Fry B, Maller J, Daly MJ. Haploview:Analysis and visualization of LD and haplotype maps. Bioinformatics 2005; 21: 263-265. Epub 2004 Aug 5. pmid: 15297300
26	Dupont WD, Plummer WD. PS power and sample size program available for free on the Internet. Control Clin Trials 1998; 19:589.
27	Ardlie KG, Kruglyak L, Seielstad M. Patterns of linkage disequilibrium in the human genome. Nat Rev Genet 2002; 3:299-309. pmid: 11967554
28	Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, et al. The structure of haplotype blocks in the human genome. Science 2002; 296:2225-2229.
29	Cobb JP, O'Keefe GE. Injury research in the genomic era. Lancet 2004; 363:2076.
30	Chen Q, Zhou H, Wu S, Wang H, Lv C, Cheng B, et al. Lack of as sociation between TREM- 1 gene polymorphisms and severe sepsis in a Chinese Han population. Hum Immunol 2008; 69:220-226. doi: 10.1016/j.humimm.2008.01.013 pmid: 18396215
31	Su L, Liu C, Li C, Jiang Z, Xiao K, Zhang X, et al. Dynamic changes in serum soluble triggering receptor expressed on myeloid cells-1 (sTREM-1) and its gene polymorphisms are associated with sepsis prognosis. Inflammation 2012; 35:1833-1843. pmid: 22798017
32	Jung ES, Kim SW, Moon CM, Shin DJ, Son NH, Kim ES, et al. Relationships between genetic polymorphisms of triggering receptor expressed on myeloid cells-1 and inflammatory bowel diseases in the Korean population. Life Sci 2011; 89:289-294. pmid: 21763322

Primer	Sequence (5'-3')		PCR length
rs2234237	CCTCTCCTTTTTCCCCACTC	CTTTGAAGGCCTCTCTGTGC	250
rs2234246	CCTCTGACTTCCAGCCACAT	TGGAATGAAGGACCAAGCAT	227

Primer	Sequence (5'-3')	PCR length
rs2234237_modify	P-TAATTTAGTTGCAGCTCGGAGTTCTTTTTTTTTTTTTTTTTTTTTT
	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-FAM
rs2234237_A	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT	150
rs2234237_A	TCAGTTCATACTTTTCCTCAGT	150
rs2234237_T	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT	152
rs2234237_T	TTTCAGTTCATACTTTTCCTCAGA	152
rs2234246_modify	P-GGTGATTACAGATTTAATTCATGTTTTTTTTTTTTTTTTTTTTTTTT
rs2234246_modify	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-FAM
rs2234246_A	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT	165
rs2234246_A	TTTTTTTTTTTGTGAGACGCTGACTTTAGAAATAGCT	165
rs2234246_G	TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT	167
rs2234246_G	TTTTTTTTTTTTTGTGAGACGCTGACTTTAGAAATAGCC	167

Variables	Survivors (n=55)	Non-survivors (n=69)	Pvalue
Age (years, mean±SD)	61±16	66±19	NS
Gender (n, %)			NS
Male	43 (78.2)	39 (56.5)
Female	12 (21.8)	30 (43.5)
Temperature (°C, mean±SD)	38.1±0.9	38.4±1.2	NS
WBC counts (×10⁹/L, mean±SD)	14.3±7.2	15.4±8.5	NS
IL-6 (pg/mL)	61.2±21.9	90.7±24.7	<0.01
APACHE II score (mean±SD)	19.6±5.7	24.2±6.2	<0.01
SOFA score (mean±SD)	8.9±3.3	11.8±3.5	<0.01
Source of infection (n, %)			NS
Lung	42 (76.4)	57 (82.6)
Abdomen	23 (41.8)	43 (62.3)
Blood	29 (52.7)	41 (59.4)
Invasive vessel	10 (18.2)	16 (23.2)
Wound	7 (12.7)	13 (18.8)
Other locus	6 (10.9)	9 (13.0)

SNP	Control (n=152)		Septic shock (n=124)		Survivors (n=55)		Non-survivors (n=69)
SNP	Count	Proportion	Count	Proportion	Count	Proportion	Count	Proportion
rs2234237
T	96	0.32	71	0.29	29	0.26	95	0.69
A	208	0.68	177	0.71	81	0.74	43	0.31
A/A	72	0.47	66	0.53	31	0.56	34	0.49
T/A	64	0.42	45	0.36	19	0.35	27	0.39
T/T	16	0.11	13	0.11	5	0.09	8	0.12
H-WP	0.27		0.75		0.41		0.27
rs2234246
G	226	0.74	179	0.72	75	0.68	104	0.75
A	78	0.26	69	0.28	35	0.32	34	0.25
A/A	6	0.04	14	0.11	6	0.11	8	0.12
G/A	66	0.43	41	0.33	23	0.42	18	0.26
G/G	80	0.53	69	0.56	26	0.47	43	0.62
H-WP	0.05		0.17		0.79			0.10

SNP	Model	Genotype	Control (n, %)	Septic shock (n, %)	OR (95%)	P value
rs2234237	Codominant	A/A	72 (47.4)	66 (53.2)	1	0.59
		A/T	64 (42.1)	45 (36.3)	0.77 (0.46, 1.27)
		T/T	16 (10.5)	13 (10.5)	0.89 (0.40, 1.99)
	Dominant	A/A	72 (47.4)	66 (53.2)	1	0.33
		T/T-A/T	80 (52.6)	58 (46.8)	0.79 (0.49, 1.27)
	Recessive	A/T-A/A	136 (89.5)	111 (89.5)	1	0.99
		T/T	16 (10.5)	13 (10.5)	1 (0.46, 2.16)
rs2234246	Codominant	G/G	80 (52.6)	69 (55.6)	1	0.03
		A/G	66 (43.4)	41 (33.1)	0.72 (0.43, 1.19)
		A/A	6 (4.0)	14 (11.3))	2.71 (0.99, 7.42)
	Dominant	G/G	80 (52.6)	69 (55.6)	1	0.62
		A/G-A/A	72 (47.4)	55 (44.4)	0.89 (0.55, 1.43)
	Recessive	G/G-A/G	146 (96.1)	110 (88.7)	1	0.02
		A/A	6 (4.0)	14 (11.3)	3.10 (1.15, 8.32)