World Journal of Emergency Medicine ›› 2013, Vol. 4 ›› Issue (1): 32-37.doi: 10.5847/wjem.j.issn.1920-8642.2013.01.006
• Original Articles • Previous Articles Next Articles
Open Access
Gan-nan Wang1, Jin-song Zhang1(
), Wei-juan Cao1, Hao Sun1, Jing Zhang1, Yao Wang1, Hang Xiao2
Received:2012-08-16
Accepted:2012-12-03
Online:2013-03-15
Published:2013-03-15
Contact:
Jin-song Zhang
E-mail:zhangjso@sina.com
Gan-nan Wang, Jin-song Zhang, Wei-juan Cao, Hao Sun, Jing Zhang, Yao Wang, Hang Xiao. Association of ALOX5, LTA4H and LTC4S gene polymorphisms with ischemic stroke risk in a cohort of Chinese in east China[J]. World Journal of Emergency Medicine, 2013, 4(1): 32-37.
Add to citation manager EndNote|Ris|BibTeX
URL: http://wjem.com.cn/EN/10.5847/wjem.j.issn.1920-8642.2013.01.006
Table 2
Primers and restriction enzymes for PCR-RFLP genotyping
| SNPs | Sequence of primers (5'-3')* | Tanneal (°C) | Length of PCR (bp) | Restriction enzymes | Length of fragment (bp) |
|---|---|---|---|---|---|
| rs2029253 A>G | F: TTCCACAGTGTATGGCCTGG(T→G)C R: ACTCTCCTCTCCATCTCTTGTCTGGA | 60.0 | 120 | Hin6I | AA: 120 |
| AG: 120, 100, 20 | |||||
| GG: 100, 20 | |||||
| rs6538697 T>C | F: TCTCCGTAAATCATGCTTGCTG(T→G)GTAC R: ACGGAGTCCCAGTCACAACTCT | 59.4 | 144 | Acc65I | TT: 144 |
| TC: 144, 122, 22 | |||||
| CC: 122, 22 | |||||
| rs730012 A>C | F: CAGGAACAGCCTGGATGGGT(G→T)AC R: ACTTTCTCCAGGGCCTTGCAG | 62.8 | 112 | KpnI | AA: 112 |
| AC: 112, 90, 22 | |||||
| CC: 90, 22 |
Table 3
Clinical characteristics of the controls and IS patients
| Variables | Controls (n=690) | Cases (n=690) | P |
|---|---|---|---|
| Age (y) | 67.01±9.59 | 67.87±9.52 | 0.097 |
| Male (%) | 54.6 | 59.7 | 0.057 |
| BMI (kg/m2) | 23.32±2.39 | 24.20±3.21 | <0.001 |
| Smoking (%) | 22.8 | 30.3 | 0.002 |
| Hypertension (%) | 26.8 | 77.1 | <0.001 |
| Diabetes (%) | 11.6 | 34.1 | <0.001 |
| SBP (mmHg) | 124.98±17.47 | 144.09±22.17 | <0.001 |
| DBP (mmHg) | 79.38±31.58 | 83.69±11.80 | 0.001 |
| TC (mmol/L) | 4.48±1.22 | 4.67±1.17 | 0.003 |
| TG (mmol/L) | 1.38±0.98 | 1.67±1.19 | <0.001 |
| HDL-C (mmol/L) | 1.28±0.36 | 1.15±0.34 | <0.001 |
| LDL-C (mmol/L) | 2.55±0.76 | 2.79±0.84 | <0.001 |
Table 4
Genotypic distributions and allelic frequencies of SNPs
| Gene | SNPs | Alleles*(1/2) | Group | Genotypes (n, %) | P▲ | 2 vs. 1 | |||
|---|---|---|---|---|---|---|---|---|---|
| 1/1 | 1/2 | 2/2 | P | OR (95%CI) | |||||
| ALOX5 | rs2029253 | G/A | Control | 274 (39.7) | 318 (46.1) | 98 (14.2) | — | 1.00 (Ref.) | |
| Patient | 224 (32.5) | 388 (56.2) | 78 (11.3) | 0.001 | 0.240 | 1.10 (0.94-1.28) | |||
| LTA4H | rs6538697 | T/C | Control | 376 (54.5) | 275 (39.9) | 39 (5.7) | — | — | 1.00 (Ref.) |
| Patient | 362 (52.5) | 267 (38.7) | 61 (8.8) | 0.073 | 0.122 | 1.14 (0.97-1.35) | |||
| LTC4S | rs730012 | A/C | Control | 556 (80.6) | 131 (19.0) | 3 (0.4) | — | — | 1.00 (Ref.) |
| Patient | 522 (75.7) | 155 (22.5) | 13 (1.9) | 0.009 | 0.009 | 1.37 (1.08-1.73) | |||
Table 5
Association results of SNPs with ischemic stroke risk according to the recessive genetic model
| SNPs | Genotype | Controls | Patients | Unadjusted | Adjusted | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| n | % | n | % | OR (95%CI) | P | OR (95%CI) | P | |||||
| ALOX5 | ||||||||||||
| rs2029253 | AA, AG | 416 | 60.3 | 466 | 67.5 | 1.00 (Ref.) | — | 1.00 (Ref.) | — | |||
| GG | 274 | 39.7 | 224 | 32.5 | 0.73 (0.59-0.91) | 0.005 | 0.72 (0.55-0.93) | 0.013 | ||||
| LTA4H | ||||||||||||
| rs6538697 | TT, TC | 651 | 94.3 | 629 | 91.2 | 1.00 (Ref.) | — | 1.00 (Ref.) | — | |||
| CC | 39 | 5.7 | 61 | 8.8 | 1.62 (1.07-2.46) | 0.022 | 1.77 (1.09-2.89) | 0.022 | ||||
| LTC4S | ||||||||||||
| rs730012 | AA, AC | 687 | 99.6 | 677 | 98.1 | 1.00 (Ref.) | — | 1.00 (Ref.) | — | |||
| CC | 3 | 0.4 | 13 | 1.9 | 4.40 (1.25-15.50) | 0.012 | 3.77 (0.92-15.50) | 0.066 | ||||
| 1 |
Jia Q, Liu LP, Wang YJ. Stroke in China. Clin Exp Pharmacol Physiol 2010; 37:259-264.
doi: 10.1111/j.1440-1681.2009.05290.x pmid: 19769611 |
| 2 |
Matarin M, Singleton A, Hardy J, Meschia J. The genetics of ischaemic stroke. J Intern Med 2010; 267:139-155.
pmid: 20175863 |
| 3 |
Yamada Y, Ichihara S, Nishida T. Proinflammatory Gene Polymorphisms and Ischemic Stroke. Curr Pharm Des 2008; 14:3590-3600.
doi: 10.2174/138161208786848793 pmid: 19075735 |
| 4 |
Zhang LF, Yang J, Hong Z, Yuan GG, Zhou BF, Zhao LC, et al. Proportion of different subtypes of stroke in China. Stroke 2003; 34:2091-2096.
doi: 10.1161/01.STR.0000087149.42294.8C pmid: 12907817 |
| 5 |
Matarin M, Brown WM, Dena H, Britton A, De Vrieze FW, Brott TG, et al. Candidate gene polymorphisms for ischemic stroke. Stroke 2009; 40:3436-3442.
doi: 10.1161/STROKEAHA.109.558015 pmid: 19729601 |
| 6 |
Crosslin DR, Shah SH, Nelson SC, Haynes CS, Connelly JJ, Gadson S, et al. Genetic effects in the leukotriene biosynthesis pathway and association with atherosclerosis. Hum Genet 2009; 125:217-229.
doi: 10.1007/s00439-008-0619-0 pmid: 19130089 |
| 7 |
Cipollone F, Mezzetti A, Fazia ML, Cuccurullo C, Iezzi A, Ucchino S, et al. Association between 5-lipoxygenase expression and plaque instability in humans. Arterioscler Thromb Vasc Biol 2005; 25:1665-1670.
pmid: 15933245 |
| 8 |
Riccioni G, Bäck M, Capra V. Leukotrienes and atherosclerosis. Curr Drug Targets 2010; 11:882-887.
doi: 10.2174/138945010791320881 pmid: 20388065 |
| 9 |
Peters-Golden M, Henderson WR. Leukotrienes. N Engl J Med 2007; 357:1841-1854.
pmid: 17978293 |
| 10 |
Bäck M. Leukotriene signaling in atherosclerosis and ischemia. Cardiovasc Drugs Ther 2009; 23:41-48.
doi: 10.1007/s10557-008-6140-9 pmid: 18949546 |
| 11 |
Zintzaras E, Rodopoulou P, Sakellaridis N. Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol 2009; 169:523-532.
pmid: 19126581 |
| 12 |
Kelly TN, Gu D, Chen J, Huang JF, Chen JC, Duan X, et al. Cigarette smoking and risk of stroke in the Chinese adult population. Stroke 2008; 39:1688-1693.
doi: 10.1161/STROKEAHA.107.505305 pmid: 18323480 |
| 13 |
Shen CD, Zhang WL, Sun K, Wang YB, Zhen YS, Hui RT. Interaction of genetic risk factors confers higher risk for thrombotic stroke in male Chinese: a multicenter case-control study. Ann Hum Genet 2007; 71:620-629.
pmid: 17521309 |
| 14 |
Bevan S, Dichgans M, Wiechmann HE, Gschwendtner A, Meitinger T, Markus HS. Genetic variation in members of the leukotriene biosynthesis pathway confer an increased risk of ischemic stroke: a replication study in two independent populations. Stroke 2008; 39:1109-1114.
doi: 10.1161/STROKEAHA.107.491969 pmid: 18323512 |
| 15 |
Hartiala J, Li D, Conti DV, Vikman S, Patel Y, Tang WH, et al. Genetic contribution of the leukotriene pathway to coronary artery disease. Hum Genet 2011; 129:617-627.
pmid: 21293878 |
| 16 |
Jawien J, Korbut R. The current view on the role of leukotrienes in atherogenesis. J Physiol Pharmacol 2010; 61:647-650.
pmid: 21224494 |
| 17 |
Klingenberg R, Hansson GK. Treating inflammation in atherosclerotic cardiovascular disease: emerging therapies. Eur Heart J 2009; 30:2838-2844.
doi: 10.1093/eurheartj/ehp477 pmid: 19880848 |
| 18 |
Rådmark O, Samuelsson B. Regulation of the activity of 5-lipoxygenase, a key enzyme in leukotriene biosynthesis. Biochem Biophys Res Commun 2010; 396:105-110.
pmid: 20494120 |
| 19 |
Bäck M. Inhibitors of the 5-lipoxygenase pathway in atherosclerosis. Curr Pharm Des 2009; 15:3116-3132.
doi: 10.2174/138161209789058020 pmid: 19754386 |
| 20 |
Dwyer JH, Allayee H, Dwyer KM, Fan J, Wu H, Mar R, et al. Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N Engl J Med 2004; 350:29-37.
pmid: 14702425 |
| 21 |
Osher E, Weisinger G, Limor R, Tordjman K, Stern N. The 5 lipoxygenase system in the vasculature: emerging role in health and disease. Mol Cell Endocrinol 2006; 252:201-206.
doi: 10.1016/j.mce.2006.03.038 pmid: 16647809 |
| 22 |
Evans JF, Ferguson AD, Mosley RT, Hutchinson JH. What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci 2008; 29:72-78.
doi: 10.1016/j.tips.2007.11.006 pmid: 18187210 |
| 23 |
Bäck M. Inflammatory signaling through leukotriene receptors in atherosclerosis. Curr Atheroscler Rep 2008; 10:244-251.
pmid: 18489853 |
| 24 |
Helgadottir A, Manolescu A, Thorleifsson G, Gretarsdottir S, Jonsdottir H, Thorsteinsdottir U, et al. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat Genet 2004; 36:233-239.
doi: 10.1038/ng1311 pmid: 14770184 |
| 25 |
Freiberg JJ, Tybjaerg-Hansen A, Sillesen H, Jensen GB, Nordestgaard BG. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease. Arterioscler Thromb Vasc Biol 2008; 28:990-996.
doi: 10.1161/ATVBAHA.107.158873 pmid: 18276912 |
| 26 |
Yamada Y, Kato K, Oguri M, Yoshida T, Yokoi K, Watanabe S, et al. Association of genetic variants with atherothrombotic cerebral infarction in Japanese individuals with metabolic syndrome. Int J Mol Med 2008; 21:801-808.
pmid: 18506375 |
| 27 | Wang GN, Wang Y, Sun H, Cao WJ, Zhang J, Xiao H, et al. Variants of the arachidonates 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of ischemic stroke in Han Chinese of eastern China. J Biomed Res 2011; 5:319-327. |
| 28 |
Moore JH. Computational analysis of gene-gene interactions using multifactor dimensionality reduction. Expert Rev Mol Diagn 2004; 4:795-803.
pmid: 15525222 |
| 29 |
Mahachie John JM, Cattaert T, Van Lishout F, Gusareva ES, Van Steen K. Lower-order effects adjustment in quantitative traits model-based multifactor dimensionality reduction. PLoS One, 2012; 7:e29594.
doi: 10.1371/journal.pone.0029594 pmid: 22242176 |
| [1] | Qingliu Zheng, Changyun Liu, Lingying Le, Qiqi Wu, Zhihong Xu, Jiyan Lin, Qiuyun Chen. ICU-acquired weakness in critically ill patients at risk of malnutrition: risk factors, biomarkers, and early enteral nutrition impact [J]. World Journal of Emergency Medicine, 2025, 16(1): 51-56. |
| [2] | Fengxia Du, Jun Zha, Yan Li, Lichao Fang, Shuyu Xia, Youjia Yu. Risk factors for postpartum posttraumatic stress disorder after emergency admission [J]. World Journal of Emergency Medicine, 2024, 15(2): 121-125. |
| [3] | Ganying Huang, Huijie Yang, Huan Yao, Xinxin Fan, Wenqin Xia, Yuansheng Xu, Xiaoling Shen, Xue Zhao. Application of multidisciplinary in situ simulation training in the treatment of acute ischemic stroke: a quality improvement project [J]. World Journal of Emergency Medicine, 2024, 15(1): 41-46. |
| [4] | Xinlei Wang, Yao Sun, Xiaoyu Ni, Shu Zhang. Development and validation of an emergency bloodstream infection score for predicting in-hospital mortality in patients with community-acquired bloodstream infections [J]. World Journal of Emergency Medicine, 2023, 14(4): 280-286. |
| [5] | Hong-yan Wei, Wen-jie Liang, Bin Li, Ling-yu Wei, An-qi Jiang, Wei-dong Chen, Peng-hao Guo, Jia Xu. Clinical characteristics and risk factors of Talaromyces marneffei infection in human immunodeficiency virus-negative patients: A retrospective observational study [J]. World Journal of Emergency Medicine, 2021, 12(4): 281-286. |
| [6] | Jing-fen Jin, Zhi-ting Guo, Yu-ping Zhang, Yuan-yuan Chen. Prediction of motor recovery after ischemic stroke using diffusion tensor imaging: A meta-analysis [J]. World Journal of Emergency Medicine, 2017, 8(2): 99-105. |
| [7] | Harun Gunes, Hayati Kandis, Ayhan Saritas, Suber Dikici, Ramazan Buyukkaya. The relationship between ischemic stroke and weather conditions in Duzce, Turkey [J]. World Journal of Emergency Medicine, 2015, 6(3): 207-211. |
| [8] | Seyran Bozkurt, Engin Deniz Arslan, Ataman Köse, Cüneyt Ayrık, Arda Yılmaz, Güllü Akbaydoğan Dündar. Lingual angioedema after alteplase treatment in a patient with acute ischemic stroke [J]. World Journal of Emergency Medicine, 2015, 6(1): 74-76. |
| [9] | Lin Li, Lin-hong Zhang, Wu-ping Xu, Jun-min Hu. Risk assessment of ischemic stroke associated pneumonia [J]. World Journal of Emergency Medicine, 2014, 5(3): 209-213. |
| [10] | Xue-zhong Xing, Yong Gao, Hai-jun Wang, Quan-hui Yang, Chu-lin Huang, Shi-ning Qu, Hao Zhang, Hao Wang, Qing-ling Xiao, Ke-lin Sun. Risk factors and prognosis of critically ill cancer patients with postoperative acute respiratory insufficiency [J]. World Journal of Emergency Medicine, 2013, 4(1): 43-47. |
| [11] | Yao Wang, Gan-nan Wang, Hao Sun, Chen Chen, Hang Xiao, Jin-song Zhang. Association of ALOX5AP with ischemic stroke in eastern Chinese [J]. World Journal of Emergency Medicine, 2012, 3(2): 108-113. |
| [12] | Misbahuddin Mohammad, Anish F. James, Raheel S. Qureshi, Sapan Saraf, Tina Ahluwalia, Joy Dev Mukherji, Tamorish Kole. Acute ischemic stroke in a child with cyanotic congenital heart disease due to non-compliance of anticoagulation [J]. World Journal of Emergency Medicine, 2012, 3(2): 154-156. |
| [13] | Jun He, Xiang-yu Hou, Sam Toloo, Jennifer R Patrick, Gerry Fitz Gerald. Demand for hospital emergency departments: a conceptual understanding [J]. World Journal of Emergency Medicine, 2011, 2(4): 253-261. |
| [14] | Jing Zhang, Yao Wang, Gan-nan Wang, Hao Sun, Tao Sun, Jian-quan Shi, Hang Xiao, Jin-song Zhang. Clinical factors in patients with ischemic versus hemorrhagic stroke in East China [J]. World Journal of Emergency Medicine, 2011, 2(1): 18-23. |
| [15] | Yu-feng Chu, Yi Jiang, Mei Meng, Jin-jiao Jiang, Ji-cheng Zhang, Hong-sheng Ren, Chun-ting Wang. Incidence and risk factors of gastrointestinal bleeding in mechanically ventilated patients [J]. World Journal of Emergency Medicine, 2010, 1(1): 32-36. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
