Association of ALOX5, LTA4H and LTC4S gene polymorphisms with ischemic stroke risk in a cohort of Chinese in east China

doi:10.5847/wjem.j.issn.1920-8642.2013.01.006

Abstract

Abstract:

BACKGROUND: Genetic variations of the 5-lipoxygenase activating protein and leukotriene A4 hydrolase genes that confer an increased risk of ischemic stroke have implicated the family of leukotrienes as potential mediators of ischemic stroke. This study aimed to explore the association ofALOX5, LTA4H and LTC4S gene polymorphisms with ischemic stroke risk in a cohort of Chinese in east China.
METHODS: This case-control study consisted of 690 patients with ischemic stroke and 690 controls. Polymorphisms of ALOX5 rs2029253 A/G, LTA4Hrs6538697 T/C, and LTC4S rs730012 A/C were genotyped by the polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. The multivariate logistic regression model was used to exclude the effects of conventional risk factors on ischemic stroke.
RESULTS: Carriers of C allele in rs730012 were more susceptible to ischemic stroke (OR: 1.37; 95%CI: 1.08-1.73; P=0.009). The rs2029253 GG genotype showed a risk-reducing effect on ischemic stroke (OR: 0.72; 95%CI:0.55-0.93; P=0.013) while the rs6538697 CC genotype had an increased risk of ischemic stroke (OR: 1.77; 95%CI: 1.09-2.89; P=0.022). The rs730012 variant was not associated with ischemic stroke risk after adjusting confounding factors (P>0.05).
CONCLUSION: The present study suggested that gene polymorphisms in the leukotrienes pathway may exert influences, with independent genetic effects, on ischemic stroke susceptibility in a cohort of Chinese in east China.

Key words: Leukotrienes, Gene polymorphisms, Risk factors, Ischemic stroke

Gan-nan Wang, Jin-song Zhang, Wei-juan Cao, Hao Sun, Jing Zhang, Yao Wang, Hang Xiao. Association of ALOX5, LTA4H and LTC4S gene polymorphisms with ischemic stroke risk in a cohort of Chinese in east China[J]. World Journal of Emergency Medicine, 2013, 4(1): 32-37.

Figures/Tables 5

Table 1

Table 2

Table 3

Table 4

Table 5

References 29

1	Jia Q, Liu LP, Wang YJ. Stroke in China. Clin Exp Pharmacol Physiol 2010; 37:259-264. doi: 10.1111/j.1440-1681.2009.05290.x pmid: 19769611
2	Matarin M, Singleton A, Hardy J, Meschia J. The genetics of ischaemic stroke. J Intern Med 2010; 267:139-155. pmid: 20175863
3	Yamada Y, Ichihara S, Nishida T. Proinflammatory Gene Polymorphisms and Ischemic Stroke. Curr Pharm Des 2008; 14:3590-3600. doi: 10.2174/138161208786848793 pmid: 19075735
4	Zhang LF, Yang J, Hong Z, Yuan GG, Zhou BF, Zhao LC, et al. Proportion of different subtypes of stroke in China. Stroke 2003; 34:2091-2096. doi: 10.1161/01.STR.0000087149.42294.8C pmid: 12907817
5	Matarin M, Brown WM, Dena H, Britton A, De Vrieze FW, Brott TG, et al. Candidate gene polymorphisms for ischemic stroke. Stroke 2009; 40:3436-3442. doi: 10.1161/STROKEAHA.109.558015 pmid: 19729601
6	Crosslin DR, Shah SH, Nelson SC, Haynes CS, Connelly JJ, Gadson S, et al. Genetic effects in the leukotriene biosynthesis pathway and association with atherosclerosis. Hum Genet 2009; 125:217-229. doi: 10.1007/s00439-008-0619-0 pmid: 19130089
7	Cipollone F, Mezzetti A, Fazia ML, Cuccurullo C, Iezzi A, Ucchino S, et al. Association between 5-lipoxygenase expression and plaque instability in humans. Arterioscler Thromb Vasc Biol 2005; 25:1665-1670. pmid: 15933245
8	Riccioni G, Bäck M, Capra V. Leukotrienes and atherosclerosis. Curr Drug Targets 2010; 11:882-887. doi: 10.2174/138945010791320881 pmid: 20388065
9	Peters-Golden M, Henderson WR. Leukotrienes. N Engl J Med 2007; 357:1841-1854. pmid: 17978293
10	Bäck M. Leukotriene signaling in atherosclerosis and ischemia. Cardiovasc Drugs Ther 2009; 23:41-48. doi: 10.1007/s10557-008-6140-9 pmid: 18949546
11	Zintzaras E, Rodopoulou P, Sakellaridis N. Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease association review and meta-analysis. Am J Epidemiol 2009; 169:523-532. pmid: 19126581
12	Kelly TN, Gu D, Chen J, Huang JF, Chen JC, Duan X, et al. Cigarette smoking and risk of stroke in the Chinese adult population. Stroke 2008; 39:1688-1693. doi: 10.1161/STROKEAHA.107.505305 pmid: 18323480
13	Shen CD, Zhang WL, Sun K, Wang YB, Zhen YS, Hui RT. Interaction of genetic risk factors confers higher risk for thrombotic stroke in male Chinese: a multicenter case-control study. Ann Hum Genet 2007; 71:620-629. pmid: 17521309
14	Bevan S, Dichgans M, Wiechmann HE, Gschwendtner A, Meitinger T, Markus HS. Genetic variation in members of the leukotriene biosynthesis pathway confer an increased risk of ischemic stroke: a replication study in two independent populations. Stroke 2008; 39:1109-1114. doi: 10.1161/STROKEAHA.107.491969 pmid: 18323512
15	Hartiala J, Li D, Conti DV, Vikman S, Patel Y, Tang WH, et al. Genetic contribution of the leukotriene pathway to coronary artery disease. Hum Genet 2011; 129:617-627. pmid: 21293878
16	Jawien J, Korbut R. The current view on the role of leukotrienes in atherogenesis. J Physiol Pharmacol 2010; 61:647-650. pmid: 21224494
17	Klingenberg R, Hansson GK. Treating inflammation in atherosclerotic cardiovascular disease: emerging therapies. Eur Heart J 2009; 30:2838-2844. doi: 10.1093/eurheartj/ehp477 pmid: 19880848
18	Rådmark O, Samuelsson B. Regulation of the activity of 5-lipoxygenase, a key enzyme in leukotriene biosynthesis. Biochem Biophys Res Commun 2010; 396:105-110. pmid: 20494120
19	Bäck M. Inhibitors of the 5-lipoxygenase pathway in atherosclerosis. Curr Pharm Des 2009; 15:3116-3132. doi: 10.2174/138161209789058020 pmid: 19754386
20	Dwyer JH, Allayee H, Dwyer KM, Fan J, Wu H, Mar R, et al. Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N Engl J Med 2004; 350:29-37. pmid: 14702425
21	Osher E, Weisinger G, Limor R, Tordjman K, Stern N. The 5 lipoxygenase system in the vasculature: emerging role in health and disease. Mol Cell Endocrinol 2006; 252:201-206. doi: 10.1016/j.mce.2006.03.038 pmid: 16647809
22	Evans JF, Ferguson AD, Mosley RT, Hutchinson JH. What's all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol Sci 2008; 29:72-78. doi: 10.1016/j.tips.2007.11.006 pmid: 18187210
23	Bäck M. Inflammatory signaling through leukotriene receptors in atherosclerosis. Curr Atheroscler Rep 2008; 10:244-251. pmid: 18489853
24	Helgadottir A, Manolescu A, Thorleifsson G, Gretarsdottir S, Jonsdottir H, Thorsteinsdottir U, et al. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat Genet 2004; 36:233-239. doi: 10.1038/ng1311 pmid: 14770184
25	Freiberg JJ, Tybjaerg-Hansen A, Sillesen H, Jensen GB, Nordestgaard BG. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease. Arterioscler Thromb Vasc Biol 2008; 28:990-996. doi: 10.1161/ATVBAHA.107.158873 pmid: 18276912
26	Yamada Y, Kato K, Oguri M, Yoshida T, Yokoi K, Watanabe S, et al. Association of genetic variants with atherothrombotic cerebral infarction in Japanese individuals with metabolic syndrome. Int J Mol Med 2008; 21:801-808. pmid: 18506375
27	Wang GN, Wang Y, Sun H, Cao WJ, Zhang J, Xiao H, et al. Variants of the arachidonates 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of ischemic stroke in Han Chinese of eastern China. J Biomed Res 2011; 5:319-327.
28	Moore JH. Computational analysis of gene-gene interactions using multifactor dimensionality reduction. Expert Rev Mol Diagn 2004; 4:795-803. pmid: 15525222
29	Mahachie John JM, Cattaert T, Van Lishout F, Gusareva ES, Van Steen K. Lower-order effects adjustment in quantitative traits model-based multifactor dimensionality reduction. PLoS One, 2012; 7:e29594. doi: 10.1371/journal.pone.0029594 pmid: 22242176

SNPs	Position in chromosome	Minor allele frequency (MAF)			HWE P value in controls
SNPs	Position in chromosome	Database^*	Case	Control	HWE P value in controls
rs2029253	45891484	0.433	0.394	0.372	0.711
rs6538697	96403610	0.367	0.282	0.256	0.219
rs730012	179220638	0.156	0.131	0.099	0.106

SNPs	Sequence of primers (5'-3')^*	T_anneal (°C)	Length of PCR (bp)	Restriction enzymes	Length of fragment (bp)
rs2029253 A>G	F: TTCCACAGTGTATGGCCTGG(T→G)C R: ACTCTCCTCTCCATCTCTTGTCTGGA	60.0	120	Hin6I	AA: 120
					AG: 120, 100, 20
					GG: 100, 20
rs6538697 T>C	F: TCTCCGTAAATCATGCTTGCTG(T→G)GTAC R: ACGGAGTCCCAGTCACAACTCT	59.4	144	Acc65I	TT: 144
					TC: 144, 122, 22
					CC: 122, 22
rs730012 A>C	F: CAGGAACAGCCTGGATGGGT(G→T)AC R: ACTTTCTCCAGGGCCTTGCAG	62.8	112	KpnI	AA: 112
					AC: 112, 90, 22
					CC: 90, 22

Variables	Controls (n=690)	Cases (n=690)	P
Age (y)	67.01±9.59	67.87±9.52	0.097
Male (%)	54.6	59.7	0.057
BMI (kg/m²)	23.32±2.39	24.20±3.21	<0.001
Smoking (%)	22.8	30.3	0.002
Hypertension (%)	26.8	77.1	<0.001
Diabetes (%)	11.6	34.1	<0.001
SBP (mmHg)	124.98±17.47	144.09±22.17	<0.001
DBP (mmHg)	79.38±31.58	83.69±11.80	0.001
TC (mmol/L)	4.48±1.22	4.67±1.17	0.003
TG (mmol/L)	1.38±0.98	1.67±1.19	<0.001
HDL-C (mmol/L)	1.28±0.36	1.15±0.34	<0.001
LDL-C (mmol/L)	2.55±0.76	2.79±0.84	<0.001

Gene	SNPs	Alleles^*(1/2)	Group	Genotypes (n, %)			P^▲	2 vs. 1
Gene	SNPs	Alleles^*(1/2)	Group	1/1	1/2	2/2		P	OR (95%CI)
ALOX5	rs2029253	G/A	Control	274 (39.7)	318 (46.1)	98 (14.2)		—	1.00 (Ref.)
			Patient	224 (32.5)	388 (56.2)	78 (11.3)	0.001	0.240	1.10 (0.94-1.28)
LTA4H	rs6538697	T/C	Control	376 (54.5)	275 (39.9)	39 (5.7)	—	—	1.00 (Ref.)
			Patient	362 (52.5)	267 (38.7)	61 (8.8)	0.073	0.122	1.14 (0.97-1.35)
LTC4S	rs730012	A/C	Control	556 (80.6)	131 (19.0)	3 (0.4)	—	—	1.00 (Ref.)
			Patient	522 (75.7)	155 (22.5)	13 (1.9)	0.009	0.009	1.37 (1.08-1.73)

SNPs	Genotype	Controls		Patients		Unadjusted		Adjusted
SNPs	Genotype	n	%	n	%	OR (95%CI)	P	OR (95%CI)	P
ALOX5
rs2029253	AA, AG	416	60.3	466	67.5	1.00 (Ref.)	—	1.00 (Ref.)	—
	GG	274	39.7	224	32.5	0.73 (0.59-0.91)	0.005	0.72 (0.55-0.93)	0.013
LTA4H
rs6538697	TT, TC	651	94.3	629	91.2	1.00 (Ref.)	—	1.00 (Ref.)	—
	CC	39	5.7	61	8.8	1.62 (1.07-2.46)	0.022	1.77 (1.09-2.89)	0.022
LTC4S
rs730012	AA, AC	687	99.6	677	98.1	1.00 (Ref.)	—	1.00 (Ref.)	—
	CC	3	0.4	13	1.9	4.40 (1.25-15.50)	0.012	3.77 (0.92-15.50)	0.066